View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12776_low_17 (Length: 233)
Name: NF12776_low_17
Description: NF12776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12776_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 53975869 - 53976075
Alignment:
| Q |
1 |
ggttcctttttatatgaacatagttaattgagatgaaagaaacttgtttgatggtctttgcatatcaattttgcattagacaccataaactactataaca |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53975869 |
ggttcctttttgtatgaacatagttaattgagatgaaagaaacttgtttgatgatctttgcatatcaattttgcattagacaccataaactactataaca |
53975968 |
T |
 |
| Q |
101 |
atagaaaatagaaattaacagatgagtagttttgaaaagtgttactccaatagctagcgagatagggttgaatatatatgaaagtgaaagataaatgggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53975969 |
atagaaaatagaaattaacagatgagtagttttgaaaattgttactccaatagctagcgagctagggttga----atatgaaagtgaaagataaatgggc |
53976064 |
T |
 |
| Q |
201 |
acacgtggcgt |
211 |
Q |
| |
|
|||||||||| |
|
|
| T |
53976065 |
gcacgtggcgt |
53976075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University