View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12777_high_3 (Length: 214)
Name: NF12777_high_3
Description: NF12777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12777_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 61 - 205
Target Start/End: Complemental strand, 31495098 - 31494962
Alignment:
| Q |
61 |
tgttcattcattgaaatttcaaggatttgtattactgtcttaatttataattatgccaacctcgagtcattttcattttccacctgcttgtgcccaataa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31495098 |
tgttcattcattgaaatttcaaggatttgtattattgtcttaatttataattatgccaacctcgagtcatt----ttttccacctgcttgtgcccaataa |
31495003 |
T |
 |
| Q |
161 |
ctttatattttagtatacccaaaagtcataggcaacagtgaacga |
205 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||| ||||||| |
|
|
| T |
31495002 |
-tttata---tattatacccaaaagtcttaggcaacaatgaacga |
31494962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 31495950 - 31495903
Alignment:
| Q |
18 |
ggactgacttagattttatgggaaacctccggcatctttcagttgttc |
65 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31495950 |
ggactgacttagattttatgggaaacttccggcatctttcagttgttc |
31495903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University