View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12778_low_7 (Length: 256)

Name: NF12778_low_7
Description: NF12778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12778_low_7
NF12778_low_7
[»] chr7 (1 HSPs)
chr7 (17-155)||(33870802-33870940)


Alignment Details
Target: chr7 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 17 - 155
Target Start/End: Original strand, 33870802 - 33870940
Alignment:
17 tcacacatctcctccgccggctacacttccccctccgacgctttctctcccaccgtagaattgtcgcaggctgaagtcggtgcttgcttgtctttcgctc 116  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
33870802 tcacacatctcctccgccggctacacttccccctccgatgctttctctcccaccgtagaattgtcgcaggctgaagtcagtgcttgcttgtctttcgctc 33870901  T
117 gagatagacctaaccttctcaggtttgtttctgtttcca 155  Q
    |||||||||||||||||||||||||||||||||||||||    
33870902 gagatagacctaaccttctcaggtttgtttctgtttcca 33870940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University