View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12778_low_7 (Length: 256)
Name: NF12778_low_7
Description: NF12778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12778_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 17 - 155
Target Start/End: Original strand, 33870802 - 33870940
Alignment:
| Q |
17 |
tcacacatctcctccgccggctacacttccccctccgacgctttctctcccaccgtagaattgtcgcaggctgaagtcggtgcttgcttgtctttcgctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33870802 |
tcacacatctcctccgccggctacacttccccctccgatgctttctctcccaccgtagaattgtcgcaggctgaagtcagtgcttgcttgtctttcgctc |
33870901 |
T |
|
| Q |
117 |
gagatagacctaaccttctcaggtttgtttctgtttcca |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33870902 |
gagatagacctaaccttctcaggtttgtttctgtttcca |
33870940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University