View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12778_low_8 (Length: 222)
Name: NF12778_low_8
Description: NF12778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12778_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 20 - 206
Target Start/End: Original strand, 50573286 - 50573472
Alignment:
| Q |
20 |
aaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaacaatttgtgnnnnnnnctcgtaatacttgattccttagc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
50573286 |
aaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaacaatttgtgtttttttctcgtaatacttgattcctttgc |
50573385 |
T |
|
| Q |
120 |
ctttatttatgctttaggatttcaagattcgaagccatatgaatgtcaacttccgcagatggttggatggtcttgcgtgttcctatg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
50573386 |
ctttatttatgctttaggatttcaagattcgcagccagatgaatgtcaacttccgcaaatggttggatggtcttgcgcgttcctatg |
50573472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 148
Target Start/End: Original strand, 50562094 - 50562138
Alignment:
| Q |
104 |
tacttgattccttagcctttatttatgctttaggatttcaagatt |
148 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||||||| ||||| |
|
|
| T |
50562094 |
tacttgattccttcggctttacttatgctttaggatttccagatt |
50562138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University