View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_high_18 (Length: 327)
Name: NF12779_high_18
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 320
Target Start/End: Complemental strand, 12277956 - 12277654
Alignment:
| Q |
18 |
gatcctatatttttaggttgttttgcctatctctttgcttgacaggttagtgttgcctcacttctcaaatggtgatatttttgtgaagcagacttctcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12277956 |
gatcctatatttttaggttgttttgcctatctctttgcttgacaggttagtgttgcctcacttctcaaatggtgatatttttgtgaagcagacttctcag |
12277857 |
T |
|
| Q |
118 |
tttctactccctcccttagtgtttgttaatgtgacatccttcatttggcgccattgtattcctccgtctcagnnnnnnnnnnnngagacttatgttgtta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12277856 |
tttctactccctcccttagtgtttgttaatgtgacatccttcatttggcgccattgtattcctccgtctcagtttttattttttgagacttatgttgtta |
12277757 |
T |
|
| Q |
218 |
tgtacggtaaaatttctacagataatggcttagggggtgcacataggtttctatctgtgttctatgcatgacaagttttgaatattcatcctgtcttctt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12277756 |
tgtacggtaaaatttctacagataatggcttagggggtgcacataggtttctatctgtgttctatgcatgacaagttttgaatattcatcctgtcttttt |
12277657 |
T |
|
| Q |
318 |
ctc |
320 |
Q |
| |
|
||| |
|
|
| T |
12277656 |
ctc |
12277654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University