View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12779_high_42 (Length: 240)

Name: NF12779_high_42
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12779_high_42
NF12779_high_42
[»] chr3 (1 HSPs)
chr3 (1-233)||(43489685-43489917)


Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 43489917 - 43489685
Alignment:
1 agaccttttcctaactcttctcagcattcgacaaacttttatgatcgttttcagttttcgggtattcctgctccaaggaatatttatgatgataatgtga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||    
43489917 agaccttttcctaactcttctcagcattcgacaaacttttatgatcgttttcagttttcgggtattcctcctgcaaggaatgtttatgatgataatgtga 43489818  T
101 ttagggcttcttctgtggcttctcatctacaatcttcatcatcgtcgccagcttcttctttgtcatcatcttcttctgcatttgtttcttctatgcaggg 200  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43489817 ttagggcttcttctatggcttctcatctacaatcttcatcatcgtcgccagcttcttctttgtcatcatcttcttctgcatttgtttcttctatgcaggg 43489718  T
201 caatacttcagtttcctcgtatttttcttctca 233  Q
    |||||||||||||||||||||||||||| ||||    
43489717 caatacttcagtttcctcgtatttttctactca 43489685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University