View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_high_47 (Length: 231)
Name: NF12779_high_47
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 72 - 221
Target Start/End: Complemental strand, 17113164 - 17113020
Alignment:
| Q |
72 |
ttggaggcattgttgcgtaaggaactcaactcagtcttgttgggaatagtggctaaagaattgaatccaagtgatgatatgatgtctataacaaccatac |
171 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
17113164 |
ttggaggcgttgttgcgtaaggaactcaactcagtcttgttggcaatagtggctaaagaattgaatccaagtgatgat-----gtttataacaaccatac |
17113070 |
T |
 |
| Q |
172 |
atgagaaaggtgctgcttttaacaattatttttggataatgtttgccttt |
221 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17113069 |
atgagaaagttgctgcttttaaccattatttttggataatgtttgccttt |
17113020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University