View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_high_53 (Length: 219)
Name: NF12779_high_53
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_high_53 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 219
Target Start/End: Complemental strand, 14136566 - 14136368
Alignment:
| Q |
21 |
catagcactcgcattaaattttgtcatcnnnnnnncacatgcattaaatgttcacgttatgctactgatgcatgcctcatcacatgcagaaaccacctgt |
120 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14136566 |
catagcactcgcattaaattttgtcataaaaaaaacacatgcattaaatgttcacgttatgctactgatgcatgcctcatcacatgcagaaaccacctgt |
14136467 |
T |
 |
| Q |
121 |
tttcctgttgaggttttaggtagggcgacatagtggaaaaatacgagttgttttgtttatatttttataaaatcaagaaatataaaacaataagcgttt |
219 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14136466 |
tttcctgttgaggttttaggtagggagacatagtggaaaaatacgagttgttttgtttatatttttataaaatcaagaaatataaaacaataagcgttt |
14136368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University