View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_high_55 (Length: 203)
Name: NF12779_high_55
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_high_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 184
Target Start/End: Complemental strand, 34033370 - 34033203
Alignment:
| Q |
17 |
gaattgctgttattttaactctgctgttattttaacttgttcttcgattttcttaggaccaccaattgaaattgctcttcattttgagtcatgttattcc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34033370 |
gaattgctgttattttaactctgctgttattttaacttgttcttcgattttcttaggaccaccaattgaaattgctcttcattttgagtcatgttatccc |
34033271 |
T |
 |
| Q |
117 |
atgattctcttagaagcaacctagcttgttgggcctcagtaaaaactaaccctaaaacttgatgtcgc |
184 |
Q |
| |
|
|||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34033270 |
atgatttgcttagaaacaccctagcttgttgggcctcagtaaaaactaaccctaaaacttgatgtcgc |
34033203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 66 - 131
Target Start/End: Original strand, 10382093 - 10382158
Alignment:
| Q |
66 |
ttcttaggaccaccaattgaaattgctcttcattttgagtcatgttattccatgattctcttagaa |
131 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
10382093 |
ttcttgggaccaccaattgtaattgctcttcgttttgagtcatgttaacccatgattcacttagaa |
10382158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University