View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_low_35 (Length: 250)
Name: NF12779_low_35
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 12 - 185
Target Start/End: Complemental strand, 34033664 - 34033488
Alignment:
| Q |
12 |
atgaaaatggatctctttcagcttaattagagtcgtaatttgaatccagtcttaaaaatacaacaat---gttaaatcttttaagggagagtattgtcaa |
108 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||| ||||||| |
|
|
| T |
34033664 |
atgataatggatctctttcatcttaactagagtcgtaatttgaatccaatcttaaaaatacaacaatattgttaaatctcttaagggagagtgttgtcaa |
34033565 |
T |
|
| Q |
109 |
ccattgtagtcttttttatgcaaaatatcacatgcagaggggttacctactgcataaccctgaccatatattaattt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34033564 |
ccattgtagtcttttttatgcaaaatatcaagtgcagaggggttacctactgcataaccctgaccatatattaattt |
34033488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University