View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_low_36 (Length: 249)
Name: NF12779_low_36
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 233
Target Start/End: Complemental strand, 41847633 - 41847406
Alignment:
| Q |
6 |
agtagcaaagggggtgtggatagagatagtgatggaacaacaactgaaacagatagaagcaaattagtgttttttgatagaaggaatgagtttgagttag |
105 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41847633 |
agtaacaatgggggtgtggatagagatagtgatggaacaacaactgaaacagatagaagcaaattagtgttttttgatagaaggaatgagtttgagttag |
41847534 |
T |
|
| Q |
106 |
aggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctgttcttgatgatggatgtactgttgctgttaagag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41847533 |
aggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctgttcttgatgatggatgtactgttgctgttaagag |
41847434 |
T |
|
| Q |
206 |
acttaaggatgctaatccttgtgatagg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41847433 |
acttaaggatgctaatccttgtgatagg |
41847406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 72 - 233
Target Start/End: Original strand, 26889516 - 26889677
Alignment:
| Q |
72 |
gtgttttttgatagaaggaatgagtttgagttagaggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctg |
171 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| || |||||| | || || ||||| |||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
26889516 |
gtgttttttgataggaggaatggatttgagttggaagatttgttgcgtgcatctgctgagatgcttgggaagggtagtttgggaactgtttatagggcag |
26889615 |
T |
|
| Q |
172 |
ttcttgatgatggatgtactgttgctgttaagagacttaaggatgctaatccttgtgatagg |
233 |
Q |
| |
|
| ||||||||||| |||| |||||||| ||||| ||||| ||||| |||||||||| |||| |
|
|
| T |
26889616 |
tgcttgatgatggtagtacggttgctgtcaagaggcttaaagatgcaaatccttgtgctagg |
26889677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 105 - 206
Target Start/End: Original strand, 49732861 - 49732962
Alignment:
| Q |
105 |
gaggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctgttcttgatgatggatgtactgttgctgttaaga |
204 |
Q |
| |
|
||||||||| |||| ||||| || || ||| | ||||| ||| | || ||||||| ||||| ||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
49732861 |
gaggatttgttacgtgcttcagctgaaatgttagggaaaggtggatttggaactgcttataaagctgttcttgatgatggaaatgttgttgctgtgaaga |
49732960 |
T |
|
| Q |
205 |
ga |
206 |
Q |
| |
|
|| |
|
|
| T |
49732961 |
ga |
49732962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 95 - 185
Target Start/End: Original strand, 22837638 - 22837728
Alignment:
| Q |
95 |
gtttgagttagaggatttgctacgagcttctgcagagatgcttgggaagggtagtttgggaactgtttatagagctgttcttgatgatgga |
185 |
Q |
| |
|
||||||| ||||||||||||| || ||||| || || ||| | |||||||||| || |||||||| |||| ||||||||||||||||||| |
|
|
| T |
22837638 |
gtttgagctagaggatttgcttcgtgcttcggcggaaatgttggggaagggtaccttaggaactgtctataaagctgttcttgatgatgga |
22837728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University