View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_low_37 (Length: 248)
Name: NF12779_low_37
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 33581290 - 33581122
Alignment:
| Q |
1 |
gattataaagctgggcattgtcattactgcgaaacttcattctcctatgtgcattcaaagaatatataacttcacgtgagacactctaagacccagaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33581290 |
gattataaagctgggcattgtcattactgcgaaacttcattctcctatgtacattcaaagaatatataacttcacgtgagacactc-aagacccagaaaa |
33581192 |
T |
|
| Q |
101 |
agttagcaatcatgtgaataataataaataatgtgcttcggaaactttatggttatggaacatttgacct |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33581191 |
agttagcaatcatgtgaataataataaataatgtgcttcggaaactttatggttatggaacatttgacct |
33581122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University