View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_low_38 (Length: 247)
Name: NF12779_low_38
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 28581321 - 28581556
Alignment:
| Q |
1 |
aaactttgattagatatatgcgggaa-tagagtgcattattagtactcctctgacctgttttgcgtgtactagcagaagattagagtaagaagagttgta |
99 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28581321 |
aaactttgattagatatatgcgggaaatagagtgcattattagtactcctctgacctgttttgcgtgtactagcagaagattagagtaagaagagttgta |
28581420 |
T |
 |
| Q |
100 |
tggcctgaaagctatggctgcagaagccaatgcagctgcagtttcacctgcaagatcagagccagggtgttgttcatcaattttgtaggcagttcttgaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28581421 |
tggcctgaaagctatggctgcagaagccaatgcagctgcagtttcacctgcaagatcagagccagggtgttgttcatcaattttgtaggcagttcttgaa |
28581520 |
T |
 |
| Q |
200 |
gtagtcatatcttcggcacgttcccaacagcagtga |
235 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
28581521 |
gtagtcatatcttcggcacgttcccagcagtagtga |
28581556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 13775778 - 13775839
Alignment:
| Q |
119 |
gcagaagccaatgcagctgcagtttcacctgcaagatcagagccagggtgttgttcatcaat |
180 |
Q |
| |
|
|||| |||||| ||||| ||||||||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
13775778 |
gcagcagccaaagcagcagcagtttcagcagcaagatcagagccaggatgttgttcatcaat |
13775839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University