View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_low_44 (Length: 241)
Name: NF12779_low_44
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 31 - 223
Target Start/End: Complemental strand, 41863581 - 41863390
Alignment:
| Q |
31 |
atagttttcttcatcaacatgaaaaacgacagagcctaagctaggattcatcggttacatgcaattttcacgatgatgcaatttatggcgtgcatacacc |
130 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41863581 |
atagttttcttgatcaacatgaaaaacgacagagcctaagctaggattcatcggttacacgcaattttcacgatgatgcaatttatggcatgcatacacc |
41863482 |
T |
 |
| Q |
131 |
cgaattcctaaaacacaattgttgcttcaggacttccaaatcataaattaagactaaaagttggaataccggtcatgttgttgaggaatttag |
223 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
41863481 |
cgaattcct-aaacacaattgttgcttcaggacttccaaatcacaaattaagactaaaagttggagtaccggtcatgctgttgaggaatttag |
41863390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 141 - 223
Target Start/End: Complemental strand, 49200661 - 49200577
Alignment:
| Q |
141 |
aaacacaattgttgcttcaggacttccaaa--tcataaattaagactaaaagttggaataccggtcatgttgttgaggaatttag |
223 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||| |||||||||||||| |||||| | |||||||||||||||| ||||||| |
|
|
| T |
49200661 |
aaacacaattgttgcttcaagagttccaaaaatcacaaattaagactaaaggttggagtgtcggtcatgttgttgagaaatttag |
49200577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University