View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_low_46 (Length: 239)
Name: NF12779_low_46
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 948911 - 948704
Alignment:
| Q |
17 |
tgtcggtcgagttggtaaagagtt-acacatatacgataagaatatgatttcagctctatcgatgtaaggatctttctcttacattatccatattgtctg |
115 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
948911 |
tgtctgtcgagttggtaaagagttgacacatatccgataagaatatgatttcagctctatcggtgtaaggatctttccgttgcattatccatattgtctg |
948812 |
T |
 |
| Q |
116 |
agccttaatgtcaacctctgatcttggtgagccttcggacccaaccgaaagtgtaacaatttttgcacaaaaaacttaactcttaacaatttcaagctac |
215 |
Q |
| |
|
||| |||||||||| ||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
948811 |
agctttaatgtcaatctctgattttggttagccttcggacccaaaagaaagtgtaacaatttttgcacaaaaaacttaactcttaacaatttcaagctac |
948712 |
T |
 |
| Q |
216 |
ctacctat |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
948711 |
ctacctat |
948704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University