View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_low_47 (Length: 239)
Name: NF12779_low_47
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_low_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 37 - 221
Target Start/End: Original strand, 47257880 - 47258064
Alignment:
| Q |
37 |
actcacgtacttgaattccctttacgtattgcaccaaattgcatacgtgtgtgagaagagacaaattgcaacatgttatgggaacaagcaatgaatatgg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47257880 |
actcacgtacttgaattccctttacgtattgcaccaaattgcatacgtgtgtgagaagagaccaattgcaacatgttatgggaacaagcaatgaatatgg |
47257979 |
T |
 |
| Q |
137 |
caattgcaattgatatgggaaaccaacacaaaacaaaccaatcacaatcggaaacaggaacaagcaaattgaagatcaacaatac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
47257980 |
caattgcaattgatatgggaaaccaacacaaaacaaaccaatcacaatcggaaacaggaaaaagcaaattgaatatcaacaatac |
47258064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University