View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_low_53 (Length: 227)
Name: NF12779_low_53
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 208
Target Start/End: Original strand, 33274556 - 33274753
Alignment:
| Q |
11 |
gtgagatgaagatataatggaaggctagctattacttaatttttcatgttgtaatttgcaagctatgagactttatatatatgtgtgtgaaaaagttgtt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33274556 |
gtgatatgaagatataatggaaggctagctattacttaatttttcatgttgtaatttgcaagctatgagactttatatatatgtgtgtgaaaaagttgtt |
33274655 |
T |
 |
| Q |
111 |
aagcttttcagcaagcaaattggattaatatattacatgcacattgtcttgggattataagtataattttttggtatgataatgacaaggtacctttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33274656 |
aagcttttcagcaagcaaattggattaatatattacatgcacattgtcttgggattataagtataattttttggtatgataatgacaaggtacctttg |
33274753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University