View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12779_low_55 (Length: 223)
Name: NF12779_low_55
Description: NF12779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12779_low_55 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 1433722 - 1433528
Alignment:
| Q |
19 |
ctgctaatgcaactacttatttttagccataaaagtttatctaaatatgataaaattccctcnnnnnnntccaaaattgttacttaagaaaattcactat |
118 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1433722 |
ctgctaatgtaactacttatttttagccataaaagtttatctaaatatgataaaatttcctcaaaaaaatccaaaattgttacttaagaaaattcactat |
1433623 |
T |
 |
| Q |
119 |
tatttttctttnnnnnnntacagtaaaagaagaggaatggagtgggagagacgtcaccttcctaagtttttgcttcaaaattccaactctctgct |
213 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1433622 |
tatttttctttaaaaaaatacagtgaaagaagaggaatggagtgggagagacgtcaccttcctaagtttttgcttcaaaattccaactctatgct |
1433528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University