View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1277D-Insertion-11 (Length: 387)
Name: NF1277D-Insertion-11
Description: NF1277D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1277D-Insertion-11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 7 - 387
Target Start/End: Complemental strand, 43409227 - 43408847
Alignment:
| Q |
7 |
aatggcaacagcagcgtgtaagccaaacatgttggcatggtgagcaagtggatattcagatttgctgaaggcagtaatatcaatagcaaaacaaggtttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409227 |
aatggcaacagcagcgtgtaagccaaacatgttggcatggtgagcaagtggatattcagatttgctgaaggcagtaatatcaatagcaaaacaaggtttg |
43409128 |
T |
|
| Q |
107 |
gttgttgtgaaggctgttcctactattccttgtccattaaaaaggtgatactcactgcacgcttcttggaatcccaatacatccatgtcaccaacataac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409127 |
gttgttgtgaaggctgttcctactattccttgtccattaaaaaggtgatactcactgcacgcttcttggaatcccaatacatccatgtcaccaacataac |
43409028 |
T |
|
| Q |
207 |
aagctgaatcaaccgttgatatgcagcaactcatagttgaaacaccacaacctgatgcaccactacttccctttcctcctccttgttgttgttgtaggca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409027 |
aagctgaatcaaccgttgatatgcagcaactcatagttgaaacaccacaacctgatgcaccactacttccctttcctcctccttgttgttgttgtaggca |
43408928 |
T |
|
| Q |
307 |
aggagcccatgttagtgctaatggtaaattgtgcgtcttgcacactgaagccaacacttccattatctcgttcacggctgc |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
43408927 |
aggagcccatgttagtgctaatggtaaattgtgcgtcttgcacactgacgccaacacttccattatctcgttcaccgctgc |
43408847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University