View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1277D-Insertion-12 (Length: 160)
Name: NF1277D-Insertion-12
Description: NF1277D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1277D-Insertion-12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 2e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 8 - 160
Target Start/End: Complemental strand, 10970736 - 10970584
Alignment:
| Q |
8 |
atcagaatgttgaggtggaagaatcttctctttggaagaacttgatgtaattcacaaagagataattctttgaccatgatattgccaggtgctactactt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10970736 |
atcagaatgttgaggtggaagaatcttctctttggaagaacttgatgtaattcacaaagagataattctttgaccatgatattgccaggtgctactactt |
10970637 |
T |
 |
| Q |
108 |
tcctgcttgttcctattgttttgcactactgcatgtttcattaatgtaggcag |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10970636 |
tcctgcttgttcctattgttttgcactactgcatgtttcattaatgtaggcag |
10970584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University