View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1277R-Insertion-9 (Length: 327)
Name: NF1277R-Insertion-9
Description: NF1277R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1277R-Insertion-9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 9 - 297
Target Start/End: Complemental strand, 40310556 - 40310268
Alignment:
| Q |
9 |
gaacttacggggaagacttatggtatttgcaatcaaacccacattatcaaataccaactccctggagaggatcttgacgctcttatttctgtttgttcca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310556 |
gaacttacggggaagacttatggtatttgcaatcaaacccacattatcaaataccaactccctggagaggatcttgacgctcttatttctgtttgttccg |
40310457 |
T |
|
| Q |
109 |
atgaggatcttcatcatatgattgaggagtatgaagagcttgaaagagctggaggatctcaacgacttaggatttttctcgtaacttcaaatgaatctga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310456 |
atgaggatcttcatcatatgattgaggagtatgaagagcttgaaagagctggaggatctcaacgacttaggatttttctcgtaacttcaaatgaatctga |
40310357 |
T |
|
| Q |
209 |
gagtccaagttctaatgaatcaagagtcaatcaacaaagtgacgtcgattatcactatgttgttgctgttaatggtatgctggatccaa |
297 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40310356 |
gagtccaagttctaatgaattaagagtcaatcaacaaagtgacgtcgattatcactatgttgttgctgttaatggtatgctggatccaa |
40310268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 57 - 100
Target Start/End: Complemental strand, 2247422 - 2247379
Alignment:
| Q |
57 |
aaataccaactccctggagaggatcttgacgctcttatttctgt |
100 |
Q |
| |
|
||||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
2247422 |
aaataccaactccctggtgaagatcttgatgctcttatttctgt |
2247379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University