View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1277_high_15 (Length: 271)
Name: NF1277_high_15
Description: NF1277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1277_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 34 - 222
Target Start/End: Original strand, 36389598 - 36389786
Alignment:
| Q |
34 |
ttctcttgatcacccttcattggtaaaagccctccatcaaatacaagaataggcttaacaccataatgtctcagcaaattcactctatgcatacaatact |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36389598 |
ttctcttgatcacccttcattggtaaaagccctccatcaaatacaagaataggcttaacaccataatgtctcagcaaattcactctatgcatacaatact |
36389697 |
T |
 |
| Q |
134 |
caatgtgcctgtaacacaatatacatagttaaccccttttctgacccaattgaacccattattaaaaatcaaatttttaccattgattt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36389698 |
caatgtgcctgtaacacaatatacatagttaaccccttttctgacccaattgaacccattattaaaaatcaaatttttaccattgattt |
36389786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University