View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1277_high_22 (Length: 210)
Name: NF1277_high_22
Description: NF1277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1277_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 15 - 124
Target Start/End: Original strand, 22043571 - 22043680
Alignment:
| Q |
15 |
tacttccatagtaagataagacaatatcaacattatcagaaaattgataatgcaattttattttgttccatccttttgttaacagatgataatggtagtc |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22043571 |
tacttccatagtaagataagacaacatcaacattatcaggaaattgataatgcaattttattttgttccatccttttgttaacagaggataatggtagtc |
22043670 |
T |
 |
| Q |
115 |
ttggttgaat |
124 |
Q |
| |
|
|||||||||| |
|
|
| T |
22043671 |
ttggttgaat |
22043680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University