View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1277_low_17 (Length: 325)
Name: NF1277_low_17
Description: NF1277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1277_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 103 - 236
Target Start/End: Complemental strand, 42883615 - 42883482
Alignment:
| Q |
103 |
accaagccaggcatcaatgacctctatgatgattnnnnnnnntgttaaagtccttttaaatttgccataaaatctatgttttcgatttacttattgtata |
202 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42883615 |
accaaaccaggcatcaatgacctctatgatgattaaaaaaaatgttaaagtccttttaaatttgccataaaatctatcttttcgatttacttattgtata |
42883516 |
T |
 |
| Q |
203 |
cttgttgtttcttttgagcttaggattacccttg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42883515 |
cttgttgtttcttttgagcttaggattacccttg |
42883482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University