View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1277_low_27 (Length: 260)
Name: NF1277_low_27
Description: NF1277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1277_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 40 - 240
Target Start/End: Original strand, 36686205 - 36686405
Alignment:
| Q |
40 |
cttggattatgactctttatattctacgcaccatactgcaattttagagaatctgtgtcatctaatctgagtgatcactcaccaatgttaacattgacaa |
139 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36686205 |
cttggattatgattctttatattctacgcaccatactgcaattttagagaatctgtgtcatctaatctgagtgatcactcaccaatgttaacattgacaa |
36686304 |
T |
 |
| Q |
140 |
catgaaccgaaccgtcactatcagaaatcggttgcacggttcccctatgaagtaactggcagggcacaaaatttgcaagtgatgctaattctgcaacagc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36686305 |
catgaaccgaaccgtcactatcagaaatcggttgcacggttcccctatgaagtaactggcagggcacaaaatttgcaagtgatgctaattcttcaacagc |
36686404 |
T |
 |
| Q |
240 |
t |
240 |
Q |
| |
|
| |
|
|
| T |
36686405 |
t |
36686405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University