View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1278-2A-Insertion-16 (Length: 198)
Name: NF1278-2A-Insertion-16
Description: NF1278-2A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1278-2A-Insertion-16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 8 - 140
Target Start/End: Complemental strand, 883414 - 883282
Alignment:
| Q |
8 |
catctttgcttctccatctccaatcttcattcctttcacaacactctcaaggtacttctcttttcttttcaattttcatccactgttgttagatttgtgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
883414 |
catctttgcttctccatctccaatcttcattcctttcacaacactctcaaggtacttctcttttcttttcaattttcatccactgttgttagatttgtgt |
883315 |
T |
|
| Q |
108 |
tttgctagatattactatatatgtgttataatt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
883314 |
tttgctagatattactatatatgtgttataatt |
883282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 158 - 198
Target Start/End: Complemental strand, 883254 - 883214
Alignment:
| Q |
158 |
catttacagaacaagggtattgagacttttgagactactaa |
198 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
883254 |
catttacaggacaagggtattgagacttttgagactactaa |
883214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University