View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1278-2A-Insertion-23 (Length: 73)
Name: NF1278-2A-Insertion-23
Description: NF1278-2A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1278-2A-Insertion-23 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 7e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 7e-30
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 42120860 - 42120925
Alignment:
| Q |
8 |
cgctacatctccttcacctcttctaatggaccaaaacctctcttctcaggtaccttaattatttat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42120860 |
cgctacatctccttcacctcttctaatggaccaaaacctctcttctcaggtaccttaattatttat |
42120925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University