View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12780_low_12 (Length: 202)
Name: NF12780_low_12
Description: NF12780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12780_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 50648552 - 50648721
Alignment:
| Q |
18 |
tttcattgtttaaccaaagaagagagtctcatttctttctcttctctttctcatcccaaagatacaatcaactttgggtaaccataatttgttatttttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50648552 |
tttcattgtttaaccaaagaagagagtctcatttctttctcttctctttctcatcccaaagatacagtcaactttgggtaaccataatttgttatttttg |
50648651 |
T |
|
| Q |
118 |
ttaaaatcaaatttgactggatnnnnnnnntgcgtggatggctcaaatcctcccaagctccccgtgcagt |
187 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50648652 |
ttaaaatcaaatttgactggataaaaaaaatgcgtggatggctcaaatcctcccaagctccccgtgcagt |
50648721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University