View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12781_high_15 (Length: 335)
Name: NF12781_high_15
Description: NF12781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12781_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 17 - 292
Target Start/End: Complemental strand, 26038152 - 26037877
Alignment:
| Q |
17 |
agataacatgtaatgtgatgtgatgcaagctctgcaacttgaagtatgaacacattcatgtatggatcctaagactttatttgcttgcaagtggtgcttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
26038152 |
agataacatgtaatgtgatgtgatgcaagctctgcaacttgaagtatgaacacattcaagtatggttcctaagactttattttcttgcaagtggtgcttc |
26038053 |
T |
 |
| Q |
117 |
ctgcattctacattaatgcttctatctgcttattttggtgaatttattattctgtccaaaaaggagcatgattcaagtgggataaatcataaaagcaaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26038052 |
ctgcattctacattaatgcttctatctgcttagtttggtgaatttattattctgtcgaaaaaggagcatgattcaagtgggataaatcataaaagcaaaa |
26037953 |
T |
 |
| Q |
217 |
gcttaattaatttatctttttgatcatttatcgttttagaatggtctcccatcttagatatggttagaaaatatga |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26037952 |
gcttaattaatttatctttttgatcatttatcgttttagaatggtctcccatcttagatatgtttagaaaatatga |
26037877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University