View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12781_high_19 (Length: 299)
Name: NF12781_high_19
Description: NF12781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12781_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 33495550 - 33495348
Alignment:
| Q |
1 |
aacatggacatgtaggaggagaacaccatggtgagtacaaaggagaacaacatggatttgtaggaggacatggtggtgagcacaaaggagagcaacatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495550 |
aacatggacatgtaggaggagaacaccacggtgagtacaaaggagaacaacatggatttgtaggaggacatggtggtgagcacaaaggagagcaacatgg |
33495451 |
T |
 |
| Q |
101 |
atttggtcatggagaccacaaggaaggacaccatggagaagagcacaaggagggatttgttgacaagatcaaggacaagattcatggtgaaggtgcagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495450 |
atttggtcatggagaccacaaggaaggacaccatggggaagagcacaaggagggatttgttgacaagatcaaggacaagattcatggtgaaggtgcagat |
33495351 |
T |
 |
| Q |
201 |
ggt |
203 |
Q |
| |
|
||| |
|
|
| T |
33495350 |
ggt |
33495348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 234 - 299
Target Start/End: Complemental strand, 33495317 - 33495252
Alignment:
| Q |
234 |
catggagagggtcatgaacatggccatgatagcagcagcagtgacagtgattagatcttaatttca |
299 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495317 |
catggagagggtcatgaacatggtcatgatagcagcagcagtgacagtgattagatcttaatttca |
33495252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 292
Target Start/End: Original strand, 9757719 - 9757748
Alignment:
| Q |
263 |
tagcagcagcagtgacagtgattagatctt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9757719 |
tagcagcagcagtgacagtgattagatctt |
9757748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University