View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12781_high_24 (Length: 242)
Name: NF12781_high_24
Description: NF12781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12781_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 46874211 - 46874435
Alignment:
| Q |
1 |
tatgggtctaagaccccaacttgaagtcaatagtagattgtggagttaaattattctcaatcagcgcaaagccctcatttcttgtgaggagctccaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
46874211 |
tatgggtctaagaccccaacttgaagtcaatagtagattgtggagttaaattattctcaatcagtgcaaagccctcatttcttgtgaggagttccaactt |
46874310 |
T |
 |
| Q |
101 |
ttttacttgtaaaggttcttttatatctttgattttatctgtcaattcttaatcaacaatagattttgaacctcttttgtcatcccttttgagaatgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46874311 |
ttttacttgtaaaggttcttttatatctttgattttatctgtcaattcttaatcaacaatagattttgaacctcttttgtcatcccttttgagaatgctt |
46874410 |
T |
 |
| Q |
201 |
ttctctttattcactgttataatcg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46874411 |
ttctctttattcactgttataatcg |
46874435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University