View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12781_low_11 (Length: 383)
Name: NF12781_low_11
Description: NF12781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12781_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 33495266 - 33494923
Alignment:
| Q |
1 |
tagatcttaatttcactgcttcatcatgttgagaggtaattaaaattttgttttgctttatgacccttttatcagaattttacgtgattactatatataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495266 |
tagatcttaatttcactgcttcatcatgttgagaggtaattaaaattttgttttgctttatgacccttttatcagaattttacgtgattactatatataa |
33495167 |
T |
 |
| Q |
101 |
-ttcgttactaacatgaatgtctatccgcttttttgtatcaaaattaataatacaagtttcaaaattttatcttagattgttnnnnnnnntcaattattt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
33495166 |
tttcgttactaacatgaatgtctatccgcttttttgtatcaaaattaataatacaagtttcaaaattttatctttgattgtt-aaaaaaatcaattattt |
33495068 |
T |
 |
| Q |
200 |
gattggaaatgaatgaaaaatagttgcacacaaaatttagtatccctaatattatggactgctattctttgtacatggatgatcataagttatgacattc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495067 |
gattggaaatgaatgaaaaatagttgcacacaa-------------------tatggactactattctttgtacatggatgatcataagttatgacattc |
33494987 |
T |
 |
| Q |
300 |
acattagcgattttgttttatctgtattttgagcttatgatgggaaagcaacttttgacgctat |
363 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33494986 |
acattagtgattttgttttatctgtattttgagcttatgatgggaaagcaacttttgacgctat |
33494923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University