View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12781_low_21 (Length: 326)
Name: NF12781_low_21
Description: NF12781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12781_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 6 - 311
Target Start/End: Original strand, 40441304 - 40441609
Alignment:
| Q |
6 |
agaagcagagagacaacagagaaatagagatatggcaatatgaacaacctttgggttagatccttgtgtggactccttcccaaatgactttccagcactg |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40441304 |
agaaacagagagacaacagagaaatagagatatggcaatatgaacaacctttgggttagatccttgtgtagactccttcccaaatgactttccagcactg |
40441403 |
T |
|
| Q |
106 |
gatatcttttgactatcaccctttgcttggttctttgatgagacattacaatcttgatcactttcatcatcagcatatgatgattgttctgatgaacttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40441404 |
gatatcttttgactatcaccctttgcttggttctttgatgagacattacaatcttgatcactttcatcatcagcatatgatgattgttctgatgaacttt |
40441503 |
T |
|
| Q |
206 |
ggttcctacttataggggaaactgatgaatggccatttctgtgttcactgtatctttttgtttctgttcgtaaacgtttctctttcaagtgtgaatcgtc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40441504 |
ggttcctacttataggggaaactgatgagtggccatttctgtgttcactgtatctttttgtttctgttcgtaaacgtttctctttcaagtgtgaatcgtc |
40441603 |
T |
|
| Q |
306 |
tgatgt |
311 |
Q |
| |
|
|||||| |
|
|
| T |
40441604 |
tgatgt |
40441609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University