View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12781_low_22 (Length: 325)
Name: NF12781_low_22
Description: NF12781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12781_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 13477382 - 13477133
Alignment:
| Q |
16 |
cactgccaacacaatgtctaatttctttctttgatacgtcccttttcaaccaaagattaactgcacctctctttacttttactttccattccatcatcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13477382 |
cactgccaacacaatgtctaatttctttctttgatacgtcccttttcaaccaaagattaactgcacctctctttacttttactttccattccatcatcaa |
13477283 |
T |
|
| Q |
116 |
agcctctaacaaaaacctcacacgtgtgatattcttttatatcctttaaataacatcattaactatttagcttttgttgattgcacttaagttatacgac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| | ||| ||| |
|
|
| T |
13477282 |
agcctctaacaaaaacctcacacgtgtgatattcttttatattc-ttaaataacatcattaactatttagcttttgttgattgcacttaattgatatgac |
13477184 |
T |
|
| Q |
216 |
taaatatattttaagaaaatatatggattcaatttgcaactgcaaacacgt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
13477183 |
taaatatattttaagaaaatatatggattgaatttgtaactgcaaacacgt |
13477133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University