View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12781_low_23 (Length: 316)
Name: NF12781_low_23
Description: NF12781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12781_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 14 - 198
Target Start/End: Complemental strand, 53233217 - 53233033
Alignment:
| Q |
14 |
ataataataatgaatgatgatgatgaaagtgttgaaggaaggacagtgatgtagtgatggtgttattagtcttagcatgcaacgcaatagaatcagaaga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53233217 |
ataataataatgaatgatgatgatgaaagtgttcaaggaaggacagtgatgtagtgatggtgttgttagtcttagcatgcaacgcaatagaatcagaaga |
53233118 |
T |
 |
| Q |
114 |
agagaaggactagtctttatttacagtcataatagttcatgagagatagctgttgctgactgacactgtactaactcaaagttcc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53233117 |
agagaaggactagtctttatttacagtcataatagttcatgagagatagctgttgctgactgacactgtactaactcaaagttcc |
53233033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 263 - 300
Target Start/End: Complemental strand, 53232975 - 53232938
Alignment:
| Q |
263 |
tctctgtttatatactgacatgatttatgagtataatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53232975 |
tctctgtttatatactgacatgatttatgagtataatg |
53232938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University