View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12781_low_25 (Length: 278)
Name: NF12781_low_25
Description: NF12781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12781_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 52867067 - 52866829
Alignment:
| Q |
17 |
actaaatttatcacacacaagcaataattata---------caacttcaacttcttcttcatgacttttccaactcaactttgtcagtgtctagaattgg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52867067 |
actaaatttatcacacacaagcaataataataatacaacttcaacttcaacttcttcttcatgacttttccaactcaactttgtcagtgtctagaattgg |
52866968 |
T |
 |
| Q |
108 |
attcttttatatcgtcagtcaataacactctggtgggacctattatatgaatgaatacatatatacatacgagtagtatcttcgtactagtatgcaacta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52866967 |
attcttttatatcgtcagtcaataacactctggtgggacctattatatgaatgaatacatatatacatacgagtagtatcttcgtactagtatgcaacta |
52866868 |
T |
 |
| Q |
208 |
tgtatgtctccaccatatt--atattagtgcgtgtgtga |
244 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52866867 |
tgtatgtctccaccatattatatattagtgcgtgtgtga |
52866829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University