View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12781_low_29 (Length: 262)
Name: NF12781_low_29
Description: NF12781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12781_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 24 - 249
Target Start/End: Complemental strand, 26776301 - 26776076
Alignment:
| Q |
24 |
cgagttattatttcttacacattactaaaatttggagttttgctttgctgcatatattcatgtatggttggagcataatttgtatttttaagtaagttta |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26776301 |
cgagttattatttcttacacattactaaaatttggagttttgctttgctgcatatattcatgtatggttggagcataatttgtatttttaagtaagttta |
26776202 |
T |
|
| Q |
124 |
tttggcacaacaactgagctgatatggcataagtacttgtcatctatttggtgtaaagtacaagttctttttaaggaggtttcccaaatagatatgagga |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26776201 |
tttggcacaacaactgagctgatatggcataagtacttgtcatctatttggtgtaaagtacaagttctttttaaggaggtttcccaaatagatatgagga |
26776102 |
T |
|
| Q |
224 |
attggatagcttttcaacattgatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
26776101 |
attggatagcttttcaacattgatgt |
26776076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University