View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12782_high_6 (Length: 227)
Name: NF12782_high_6
Description: NF12782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12782_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 35756347 - 35756509
Alignment:
| Q |
18 |
aaagtgaggagaagttagagttaaagccatgttagttaaattcaggagtggcgacggtggcagttacggtggttttgcatgccgggaacggaataaggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35756347 |
aaagtgaggagaagttagagttaaagccatgttagttaaattcaggagtggcgacggtggcagttacggtggttttgcatgccgggaacggaataaggta |
35756446 |
T |
 |
| Q |
118 |
ggtagttggagctgtgtaacgattaaaacagaaatgcatgaataatttatccggatttggatt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35756447 |
ggtagttggagctgtgtaacgattaaaacagaaatgcatgaataatttatccggatttggatt |
35756509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University