View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12782_low_7 (Length: 226)
Name: NF12782_low_7
Description: NF12782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12782_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 39912431 - 39912623
Alignment:
| Q |
16 |
tgaatagagccaaagtagtgaatgtgcgtgatgaaaaacacttagaatttgaagaaagtgggttgaatgaaacatcagaaaacctaggccttaatctttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39912431 |
tgaatagagccaaagtagtgaatgtgcgtgatgaaaaacacttagaatttgaaggaagtgggttgaatgaaacatcagaaaacctaggccttaatctttg |
39912530 |
T |
|
| Q |
116 |
acactgtaattgaagcaaagggtctttcttcaaatccacggaataagtactagagacactagacatgagtaacatagtttgagccattgctat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39912531 |
acactgtaattgaagcaaagggtctttcttcaaatccacggaataagtactagagacactagacatgagtaacatagtttgagccattgctat |
39912623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University