View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12783_low_10 (Length: 231)
Name: NF12783_low_10
Description: NF12783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12783_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 35074141 - 35073978
Alignment:
| Q |
1 |
acattttacactttgaattttatagctggttgattcaatacaataccattcaaaattcaggaatttcaacaaaaaataaatcaatgcaccaagccacagc |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35074141 |
acattttacactgtgaattttatagctggttgattcaatacaataccattcaaaattcaggaatttcaacaaaaaataagtcaatgcaccaagccacagc |
35074042 |
T |
 |
| Q |
101 |
agaacaaattgggaagacaaattatgcaacaaaaattagtggtgccggagtaactaccacctaa |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074041 |
agaacaaattgggaagacaaattatgcaacaaaaattagtggtgccggagtaactaccacctaa |
35073978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 35073976 - 35073932
Alignment:
| Q |
187 |
aagtgggatttttagcggctttagggagaaccgaagccgaatcta |
231 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
35073976 |
aagtgggatttttagtggctttagggagaaccgaagccgcatcta |
35073932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University