View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12783_low_5 (Length: 358)
Name: NF12783_low_5
Description: NF12783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12783_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 26 - 301
Target Start/End: Complemental strand, 32346580 - 32346301
Alignment:
| Q |
26 |
ggtatcctgtgaaaactaaaatatgttgtttgtggttctgttttcaaacatcaaagagggtaaaactgagttctagggagagagaaaaagagtgaataag |
125 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
32346580 |
ggtatccggtgaaaactaaaatatgttgtttgtggttctgttttcaaacatcaaagagggtaaaactgagttttagggagagaaaaaaagagtgaataag |
32346481 |
T |
 |
| Q |
126 |
caatttgatcctaaaacgtgtaagttt----atcaacaggttcatccataaaattatagtgtttttgtcaaaacaattcatttattagcgtcttttgttc |
221 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32346480 |
caatttgatcctaaaacgtgtaagcttcggaatcaacagattcatccataaaattatagtgtttttgtcaaaacaattcatttattaacgtcttttgttc |
32346381 |
T |
 |
| Q |
222 |
cactccggctcaacatgttaaatgaacgattgtcatttcatgtttatatcacatcattgtcacatcttcaaagaaatgat |
301 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32346380 |
cactgtggctcaacatgttaaatgaacgattgtcatttcatgtttatatcacatcattgtcacatcttcaaagaaatgat |
32346301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University