View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12783_low_9 (Length: 236)
Name: NF12783_low_9
Description: NF12783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12783_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 39 - 137
Target Start/End: Complemental strand, 35505171 - 35505073
Alignment:
| Q |
39 |
gatattcactttgaacatcttcaatgaggtatataagagggtttcatagaaaaataatcgagttgcttattttccctacccattaggagaatatgagtt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35505171 |
gatattcactttgaacatcttcaatgaggtatataagagggtttcatagaaaaatgaccgagttgcttattttccctacccattaggagaatatgagtt |
35505073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 169 - 226
Target Start/End: Complemental strand, 35505073 - 35505016
Alignment:
| Q |
169 |
tagcatatgtaagatatggtagttcatgcaaataaaaattgtggattgcttcttctct |
226 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35505073 |
tagcatatgtaacatatggtacttcatgcaaataaaaattgtggattgcttcttctct |
35505016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University