View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12783_low_9 (Length: 236)

Name: NF12783_low_9
Description: NF12783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12783_low_9
NF12783_low_9
[»] chr5 (2 HSPs)
chr5 (39-137)||(35505073-35505171)
chr5 (169-226)||(35505016-35505073)


Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 39 - 137
Target Start/End: Complemental strand, 35505171 - 35505073
Alignment:
39 gatattcactttgaacatcttcaatgaggtatataagagggtttcatagaaaaataatcgagttgcttattttccctacccattaggagaatatgagtt 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||    
35505171 gatattcactttgaacatcttcaatgaggtatataagagggtttcatagaaaaatgaccgagttgcttattttccctacccattaggagaatatgagtt 35505073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 169 - 226
Target Start/End: Complemental strand, 35505073 - 35505016
Alignment:
169 tagcatatgtaagatatggtagttcatgcaaataaaaattgtggattgcttcttctct 226  Q
    |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||    
35505073 tagcatatgtaacatatggtacttcatgcaaataaaaattgtggattgcttcttctct 35505016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University