View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12784_low_5 (Length: 351)
Name: NF12784_low_5
Description: NF12784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12784_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 9e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 68 - 197
Target Start/End: Complemental strand, 45633855 - 45633726
Alignment:
| Q |
68 |
gagaaatgatagatcgaccactttgttttgtacacccttttctacacccgctgatgtggcatcttttgcctggtggaaattaaattatttttcatttaaa |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45633855 |
gagaaatgatagatcgaccactttgttttgtacaccctttactacacctgctgatgtggcatcttttgcctggtggaaattaaattatttttcatttaaa |
45633756 |
T |
|
| Q |
168 |
aaacaaaatacaaatcaaaccttacacacc |
197 |
Q |
| |
|
|||||||||||| || |||||||||||||| |
|
|
| T |
45633755 |
aaacaaaatacatattaaaccttacacacc |
45633726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 260 - 331
Target Start/End: Complemental strand, 45633669 - 45633598
Alignment:
| Q |
260 |
gttcccatttccagccaaccatgtagccgccttcactccaaacgacaccacactcacgccgtatcctgctct |
331 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
45633669 |
gttccaatttccagccaaccatgtagccgccttcactccaaacgacaccacactcgcgccgtatcatgctct |
45633598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 29384816 - 29384874
Alignment:
| Q |
139 |
ggtggaaattaaattatttttcattt-aaaaaacaaaatacaaatcaaaccttacacacc |
197 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
29384816 |
ggtggaaattaaattattttttatttaaaaaaacaaaata-agatcaaaccttacacacc |
29384874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 42159017 - 42159049
Alignment:
| Q |
20 |
gttcgccattgctgttttggaaaccctaaaatt |
52 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
42159017 |
gttcgtcattgctgttttggaaaccctaaaatt |
42159049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University