View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12785_high_4 (Length: 211)
Name: NF12785_high_4
Description: NF12785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12785_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 48 - 195
Target Start/End: Original strand, 33600018 - 33600165
Alignment:
| Q |
48 |
gaaatacgtctaggtgctcacgagcagaaattgactcgcggtagcattgattgaactaatcaaagactgaatttttaagagaaattcagatacagaattc |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600018 |
gaaatacgtctaggtgctcacgagcagaaattgactctcggtagcattgattgaactaatcaaagactgaatttttaagagaaattcagatacagaattc |
33600117 |
T |
 |
| Q |
148 |
ttccaggtttcaagcacggtgcttcacaaatcagaacaaagctggcag |
195 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600118 |
ttctaggtttcaagcacggtgcttcacaaatcagaacaaagctggcag |
33600165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University