View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12785_low_5 (Length: 265)
Name: NF12785_low_5
Description: NF12785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12785_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 245
Target Start/End: Original strand, 45540540 - 45540766
Alignment:
| Q |
19 |
caacatccacatatgaattgtcgcaagagagttcattcaatgagaaaacaaatacaaataacagtgactccgatgatgtagttaaatcatggcaaaccca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540540 |
caacatccacatatgaattgtcgcaagaaagttcattcaatgagaaaacaaatacaaataacagtgactccgatgatgtagttaaatcatggcaaaccca |
45540639 |
T |
 |
| Q |
119 |
gccatctccatgtgatattgtatcaacaaatgttgaatcacatcacccctttaaagaaattgagaaaggacaacagggagtggatgatactatccatacg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540640 |
gccatctccatgtgatattgtatcaacaaatgttgaatcacatcacccctttaaagaaattgagaaaggacaacagggagtggatgatactatccataca |
45540739 |
T |
 |
| Q |
219 |
gggacatcatcttttccaactttagaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45540740 |
gggacatcatcttttccaactttagaa |
45540766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University