View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12786_high_7 (Length: 237)
Name: NF12786_high_7
Description: NF12786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12786_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 16487998 - 16487767
Alignment:
| Q |
1 |
ttgaatgaaagcatcggtttcacgtgttcggggagttcggtaactttcttccccttgatctcgctgtagaatctcctcatcgccattgctgaattgctcg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16487998 |
ttgaatgaaagcattggtttcacgtgttcggggagttcggtaactttcttccccttgatctcgctgtagaatctcctcatcgccattgctgaattgctcg |
16487899 |
T |
|
| Q |
101 |
attgattccgcaaaccctagaaatttagattcagaacgctgtttctctgaatacggaaatgaacgctgtttcacttgtggttgaaaatgaaattgggtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16487898 |
attgattccgcaaaccctagaaatttagattcagaacgctgtttctctgaatacggaaatgaacgctgtttcacttgtggttgaaaatgaaattgggtga |
16487799 |
T |
|
| Q |
201 |
attggtgtattgccccattcatctcactcgac |
232 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| |
|
|
| T |
16487798 |
attggtgtattgccccattcatgtcacccgac |
16487767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University