View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12786_low_6 (Length: 250)

Name: NF12786_low_6
Description: NF12786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12786_low_6
NF12786_low_6
[»] chr7 (1 HSPs)
chr7 (11-127)||(45324324-45324440)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 11 - 127
Target Start/End: Original strand, 45324324 - 45324440
Alignment:
11 cacagaagctttggaatttggtttggagaatgaattaatactccccttctttacagattgtaatcattcgtgcagttttgtatcaaattttcttcaaatt 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45324324 cacagaagctttggaatttggtttggagaatgaattaatactccccttctttacagattgtaatcattcgtgcagttttgtatcaaattttcttcaaatt 45324423  T
111 aagaaatatttcacttg 127  Q
    |||||||||||||||||    
45324424 aagaaatatttcacttg 45324440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University