View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12786_low_6 (Length: 250)
Name: NF12786_low_6
Description: NF12786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12786_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 11 - 127
Target Start/End: Original strand, 45324324 - 45324440
Alignment:
| Q |
11 |
cacagaagctttggaatttggtttggagaatgaattaatactccccttctttacagattgtaatcattcgtgcagttttgtatcaaattttcttcaaatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45324324 |
cacagaagctttggaatttggtttggagaatgaattaatactccccttctttacagattgtaatcattcgtgcagttttgtatcaaattttcttcaaatt |
45324423 |
T |
 |
| Q |
111 |
aagaaatatttcacttg |
127 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45324424 |
aagaaatatttcacttg |
45324440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University