View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12787_high_27 (Length: 247)
Name: NF12787_high_27
Description: NF12787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12787_high_27 |
 |  |
|
| [»] chr4 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 32 - 247
Target Start/End: Original strand, 48866301 - 48866515
Alignment:
| Q |
32 |
cctgtcaatttgatattccaaccacccttcatacattttgatttttgagatcaccattggctgacctatctctggattacacctctttttggctgcacat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48866301 |
cctgtcaatttgatattccaaccacccttcatacattttgatttttgagatcaccattggctgacctatctctggatcacacctctttttggctgcacat |
48866400 |
T |
 |
| Q |
132 |
ttcagcatttctctatcaagacaaaaatatgatgggacgtgagttttgttgaactttaagtcttggtcaaaccataccggttgctgctgtattgattgta |
231 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48866401 |
ttcagcatttctctat-aagacaaaaatatgatgggacgtgagttttgttgaactttaagtcttggtcaaaccataccggttgctgctgtattgattgta |
48866499 |
T |
 |
| Q |
232 |
ttatttttgtcaaacc |
247 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
48866500 |
ttatttttgtcaaacc |
48866515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 129 - 207
Target Start/End: Original strand, 48873380 - 48873458
Alignment:
| Q |
129 |
catttcagcatttctctatcaagacaaaaatatgatgggacgtgagttttgttgaactttaagtcttggtcaaaccata |
207 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48873380 |
catttcagcatttctttatcaaaacaaaaatatgatgggacacgagttttgttgaactttaagtcttggtcaaaccata |
48873458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 129 - 207
Target Start/End: Original strand, 48878684 - 48878762
Alignment:
| Q |
129 |
catttcagcatttctctatcaagacaaaaatatgatgggacgtgagttttgttgaactttaagtcttggtcaaaccata |
207 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48878684 |
catttcagcatttctttatcaaaacaaaaatatgatgggacacgagttttgttgaactttaagtcttggtcaaaccata |
48878762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 32 - 95
Target Start/End: Original strand, 48856820 - 48856883
Alignment:
| Q |
32 |
cctgtcaatttgatattccaaccacccttcatacattttgatttttgagatcaccattggctga |
95 |
Q |
| |
|
|||||||||||||||||||||| |||| || ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
48856820 |
cctgtcaatttgatattccaacgacccctcttacattttgatttctgagatcactattggctga |
48856883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University