View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12787_low_15 (Length: 340)
Name: NF12787_low_15
Description: NF12787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12787_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 158 - 322
Target Start/End: Complemental strand, 46354868 - 46354704
Alignment:
| Q |
158 |
cactagagaaaatatgaaatggtttagaaatattttttgcattaatttttacttcaaaggtatcataatttatttatagagaaattcatgtc-cttagtg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||| | |
|
|
| T |
46354868 |
cactagagaaaatatgaaatggtttagaaatattttttgcattaatttttacttcaaag-tatcataatttatttatagagaaattgatgtcacttaggg |
46354770 |
T |
|
| Q |
257 |
aaggaaaacaagtcttgaaccacattttgcaatgtgtattccgaatagctaagtattactattaac |
322 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46354769 |
atggaaaacaagtcttgaaccacattttgcaatgtgtattccaaatagctaagtattactattaac |
46354704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 15 - 144
Target Start/End: Complemental strand, 46354982 - 46354853
Alignment:
| Q |
15 |
gatgtaaaagataatcttaagaatcatcttcataatactttataatatttgacattaatcgtatcaatcaatgatagttttaaaaataaaattctcttaa |
114 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46354982 |
gatgtaaaggataattttaagaatcatcttcataatactttataatatttgacattaatcgtatcaatcaatgatagttttaaaaataaaactctcttaa |
46354883 |
T |
|
| Q |
115 |
ttactctctaacaacactagagaaaatatg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46354882 |
ttactctctaacaacactagagaaaatatg |
46354853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University