View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12787_low_17 (Length: 328)
Name: NF12787_low_17
Description: NF12787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12787_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 10 - 211
Target Start/End: Original strand, 54277820 - 54278024
Alignment:
| Q |
10 |
cgttggatatggtacatcaaagggtttggattacattatagtgaagaattcatggggagcaaagtggggtgagaaagggtttattaggatgaagagaaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54277820 |
cgttggatatggtacatcaaagggtttggattacattatagtgaagaattcatggggagcaaagtggggtgagaaagggtttattaggatgaagagaaac |
54277919 |
T |
 |
| Q |
110 |
attggaaagtctgaagggatttgtggactctacaagatggcttcttatcccactaaaaagaaataagatttaacttcatacatcgt---tcaattgaatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54277920 |
attggaaagtctgaagggatttgtggactctacaagatggcttcttatcccactaaaaagaaataagatttaacttcatacatcgttgatcaattgaatc |
54278019 |
T |
 |
| Q |
207 |
tcata |
211 |
Q |
| |
|
||||| |
|
|
| T |
54278020 |
tcata |
54278024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 311
Target Start/End: Original strand, 54278089 - 54278124
Alignment:
| Q |
276 |
gaagcaatgttattgtaatgtcttcaattcaataat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
54278089 |
gaagcaatgttattgtaatgtcttcaattcaataat |
54278124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University